HOME

Malaria IDC Strain Comparison Database

February 9, 2010

Oligo ID	PlasmoDB ID	Description
opfg0005	PFE0625w	GTPase, putative

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfg0005	UNIQUE	42	53	0.9	92	N/A	1679.9

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfg0005	UNIQUE	45	11	0.8	71	70	2665

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfg0005	UNIQUE	33	43	1.1	83	93	5027.58

Oligo Sequence

5' GAAATAAGATCGATTTAAAGAATGATAGGAATGTAAGTTATGAGGAGGGGAAAGAATTAGCTGACAGTTG

Automated Predictions	Description
chr5.gen_62	100% identity to 100% of (AJ409198) putative GTPase [Plasmodium falciparum]
chr5.glm_135	96% identity to 96% of (AJ409198) putative GTPase [Plasmodium falciparum]
chr5.phat_148	100% identity to 100% of (AJ409198) putative GTPase [Plasmodium falciparum]