HOME

Malaria IDC Strain Comparison Database

February 9, 2010

Oligo ID	PlasmoDB ID	Description
opff72487	MAL6P1.292	integral membrane protein

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opff72487	UNIQUE	47	23	5.8	95	N/A	438.4

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opff72487	UNIQUE	43	21	3.4	97	68	581.8

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opff72487	UNIQUE	39	20	8	99	85	1238.91

Oligo Sequence

5' GATGTTGTTTCATCAAAAGTTATTGTAAATCCACACCAAGTCTCAAAATTACCTGAACAAGTCAGGCTAA

Automated Predictions	Description
chr6.gen_248	24% identity to 92% of hypothetical protein PFB0765w - malaria parasite (Plasmodium falciparum)
chr6.glm_163	24% identity to 99% of hypothetical protein PFB0145c - malaria parasite (Plasmodium falciparum)
chr6.phat_155	30% identity to 77% of (AK010312) putative [Mus musculus]