HOME

Malaria IDC Strain Comparison Database

February 9, 2010

Oligo ID	PlasmoDB ID	Description
opfblob0065	PF08_0003	tryptophan/threonine-rich antigen

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfblob0065	UNIQUE	53	31	5.9	96	N/A	1226

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfblob0065	UNIQUE	50	28	3.5	92	61	1316.9

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
opfblob0065	UNIQUE	3	30	7	96	87	4302.13

Oligo Sequence

5' GACAAATGATAGACCAAAAAGTAGCACAAATAATGAACCATGACTTAGAATCAACAGCAGAACAAAAAGC

Automated Predictions	Description
chr8.gen_4	99% identity to 100% of (AY027491) tryptophan/threonine-rich antigen [Plasmodium falciparum]
chr8.glm_13	64% identity to 100% of (AY027491) tryptophan/threonine-rich antigen [Plasmodium falciparum]
chr8.phat_23	99% identity to 100% of (AY027491) tryptophan/threonine-rich antigen [Plasmodium falciparum]