HOME

Malaria IDC Strain Comparison Database

February 9, 2010

Oligo ID	PlasmoDB ID	Description
m49509_6	PF13_0119	small GTPase Rab11

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
m49509_6	UNIQUE	10	21	0.9	72	N/A	1462.4

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
m49509_6	UNIQUE	47	29	1	89	N/A	1175.8

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
m49509_6	UNIQUE	42	29	1.3	86	83	3342.32

Oligo Sequence

5' GAGGCAACTAATGTAGAGCTAGCTTTTCATCAATTATTAAATGGTTATATTTATATTTCTCACCTTGAAC

Automated Predictions	Description
chr13.gen_99	100% identity to 100% of (X93161) small GTPase rab11 [Plasmodium falciparum]
chr13.glm_235	98% identity to 96% of (X93161) small GTPase rab11 [Plasmodium falciparum]
chr13.phat_234	100% identity to 100% of (X93161) small GTPase rab11 [Plasmodium falciparum]