HOME

Malaria IDC Strain Comparison Database

February 9, 2010

Oligo ID	PlasmoDB ID	Description
f45253_1	MAL7P1.164	adaptor-related protein, putative

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f45253_1	UNIQUE	53	45	0.6	64	N/A	239.9

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f45253_1	UNIQUE	21	47	1.5	73	61	273.2

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f45253_1	UNIQUE	9	41	1.6	83	90	768.739

Oligo Sequence

5' AGAAAAAAATGATGATAAAAAAAGAGAAGTGTTAAAAAAGGTAATAGCCTATATGACTTTAGGTGTGGAT

Automated Predictions	Description
chr7.phat_278	36% identity to 77% of beta-adaptin-like protein A - Arabidopsis thaliana