HOME

Malaria IDC Strain Comparison Database

November 22, 2009

Oligo ID	PlasmoDB ID	Description
f4218_1	MAL7P1.164	adaptor-related protein, putative

		3D7	Dd2	HB3

3D7 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f4218_1	UNIQUE	11	53	1	54	N/A	279.2

Dd2 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f4218_1	UNIQUE	22	46	1.6	77	72	412.5

HB3 isolate
OligoID	Status	Maximum Hour	Minimum Hour	Amplitude (log2)	Score (%)	CGH %3D7	Avg. Med. Intensity
f4218_1	UNIQUE	9	40	1.7	88	77	839.098

Oligo Sequence

5' TACAGCTGATCAAATGTACAATAATGTAATAGATCATAAGCACGCAATACATGACAAAAATGAAAATAAT

Automated Predictions	Description
chr7.gen_175	35% identity to 72% of beta-adaptin-like protein A - Arabidopsis thaliana
chr7.glm_304	35% identity to 72% of beta-adaptin-like protein A - Arabidopsis thaliana
chr7.phat_278	36% identity to 77% of beta-adaptin-like protein A - Arabidopsis thaliana